Fri. Mar 19-27, 2020 Geoduck EPI Trimming Updated!

BSseq method clarification

determined the following during conference call:
- samples were digested with MspI but not size selected prior to library prep
- digested genomic DNA was randomly primed during first round of PCR in library kit (see kit schematic)
  - all read start sites should be now be random and no longer at the MspI cut site
  - we DO want to deduplicate because we do not expect reads to stack up since they are randomly primed
- we should follow bismark user guide recommendations for TruSeq DNA-Methylatin Kit for trimming
  - trim an extra 8bp off both ends of reads

New Trimming Pilot

Script here: 20200319_TG_EPI-Test.sh
Slurm file here: slurm-2358892.out
Parameter description:
- 8 bp were clipped off the beginning and end of each read using the following TG parameters:
```
  --clip_R1 8  
  --clip_R2 8 
  --three_prime_clip_R1 8 
  --three_prime_clip_R2 8 
```
- adapters were either specified using the illumina sequences provided on page 45 of the Illumina adapter sequences document or were identified using the default settings
```
  #specifying adapters
  --adapter AGATCGGAAGAGCACACGTCTGAAC 
  --adapter2 AGATCGGAAGAGCGTCGTGTAGGGA 
		
  #default settings did not include the --adapter and --adapter2 options
```
newly trimmed reads are on Gannet here https://gannet.fish.washington.edu/metacarcinus/Pgenerosa/analyses/20200319/ and mox here: /gscratch/scrubbed/strigg/analyses/20200319
- reads with specified adapters trimmed:
  - specify_a/EPI-167_S10_L002_R1_001_val_1.fq.gz
  - specify_a/EPI-167_S10_L002_R2_001_val_2.fq.gz
- reads with TrimGalore! defaults adapter trimmed:
  - EPI-167_S10_L002_R1_001_val_1.fq.gz
  - EPI-167_S10_L002_R2_001_val_2.fq.gz
FastQC files:
- BEFORE (raw data):
  - EPI-167 R1
  - EPI-167 R2
- AFTER trimming with adapter specified):
  - EPI-167 R1
  - EPI-167 R2
- AFTER trimming with default adapters:
  - EPI-167 R1
  - EPI-167 R2
Aligned reads
- Steven’s IGV session https://raw.githubusercontent.com/sr320/nb-2020/master/P_generosa/igv/032020-igv_session.xml
- IGV screen capture video
- Steven’s nb post
Assciated github issues: - https://github.com/hputnam/Geoduck_Meth/issues/3 - https://github.com/RobertsLab/resources/issues/860

New Trimming on all data

Pilot trimming looked good and there wasn’t a big difference between specifying the exact adapter sequence or using default adapter settings so we decided to go with default
copied all raw data to mox: https://gannet.fish.washington.edu/metacarcinus/Pgenerosa/analyses/20200320/readme.txt
Ran this script on mox: 20200320_TrimGpgnrMeth1.sh
- slurm file
- Trimmed reads are here: https://gannet.fish.washington.edu/metacarcinus/Pgenerosa/analyses/20200320/TG_FASTQS/
- FastQC files are here: https://gannet.fish.washington.edu/metacarcinus/Pgenerosa/analyses/20200320/TG_FASTQS/FastQC/
- MultiQC report is here: https://gannet.fish.washington.edu/metacarcinus/Pgenerosa/analyses/20200320/multiqc_report.html
- OFS was updated with newly trimmed reads https://github.com/hputnam/Geoduck_Meth/issues/4

Alignments on newly trimmed data

Steven ran this Bismark script on mox: https://github.com/hputnam/Geoduck_Meth/blob/master/code/03-bismark.sh
- slurm file
- Bismark alignments are here: https://gannet.fish.washington.edu/seashell/bu-mox/scrubbed/032120-fds/
- Bismark summary report: https://gannet.fish.washington.edu/seashell/bu-mox/scrubbed/032120-fds/bismark_summary_report.html
OFS was updated with new alignment files https://github.com/hputnam/Geoduck_Meth/issues/4